Molecular characterization of Salmonella isolated from internal organs of dead turkey and its antimicrobial activity pattern

Authors

  • Nazmi Ara Rumi Department of Microbiology, Hajee Mohammad Danesh Science & Technology University, Dinajpur, Bangladesh
  • Md Aoulad Hosen Department of Microbiology, Hajee Mohammad Danesh Science & Technology University, Dinajpur, Bangladesh
  • Tonmoy Kundu Department of Microbiology, Hajee Mohammad Danesh Science & Technology University, Dinajpur, Bangladesh
  • Md Shajedur Rahman Department of Medicine, Surgery and Obstetrics, Hajee Mohammad Danesh Science & Technology University, Dinajpur, Bangladesh

DOI:

https://doi.org/10.3329/ajmbr.v5i3.43591

Keywords:

antimicrobial resistance; Salmonella enterica; virulence gene; turkey; internal organs

Abstract

Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans.

Asian J. Med. Biol. Res. June 2019, 5(3): 219-225

Downloads

Download data is not yet available.
Abstract
251
PDF
296

Downloads

Published

2019-10-15

How to Cite

Rumi, N. A., Hosen, M. A., Kundu, T., & Rahman, M. S. (2019). Molecular characterization of Salmonella isolated from internal organs of dead turkey and its antimicrobial activity pattern. Asian Journal of Medical and Biological Research, 5(3), 219–225. https://doi.org/10.3329/ajmbr.v5i3.43591

Issue

Section

Research Articles